Prev. |  KEGG KO K03033 > 

RIKEN DNA Bank Human Resource - PSMD3

Gene ID NCBI Gene 5709 |  KEGG hsa:5709
Gene Symbol PSMD3
Protein Name proteasome 26S subunit, non-ATPase 3
Synonyms P58|RPN3|S3|TSTA2
Ortholog resource in our bank

  PSMD3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005369 IRAK013H01 pCMV-SPORT6 BC012302 NM_002809 Full/var
HGX005938 IRAK014O02 pCMV-SPORT6 BC020518 NM_002809 Full
HGX019761 IRAK049G17 pCMV-SPORT6 BC025686 NM_002809 Full
HGY083019 IRAL007J03 pOTB7 BC000074 NM_002809 Full
HGY085925 IRAL014N13 pOTB7 BC004859 NM_002809 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007796 W01A019I04 pENTR-TOPO flj0033d10 AK022896 NM_002809.4 full done
HGE007800 W01A019I08 pENTR-TOPO flj0033d10 AK022896 NM_002809  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047700 ARe19E04 pKA1U5 NM_002809.2  
GAGAAGGCCCAGCGCCGGGAAGGGGTTTGCAGCTGCTCCGTCATCGTGCGGCCCGACGCT
HKR179210 ARi48A10 pGCAP10 NM_002809.2  
GAGAAGGCCCAGCGCCGGGAAGGGGTTTGCAGCTGCTCCGTCATCGTGCGGCCCGACGCT
HKR203572 ARiS008P12 pGCAP10 NM_002809.2  
GGCAGCTGCTCCGTCATCGTGCGGCCCGACGCTATCTCGCGCTCGTGTGCAGGCCCGGCT
HKR365260 RBd13C12 pGCAP10 NM_002809.2  
TGATCTCGCGCTCGTGTGCAGGCCCGGCTCGGCTCCTGGTCCCCGGTGCGAGGGTTAACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl