Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01872

HP ID(1) HP01872
Gene ID(2) 55872
Gene Symbol finder PBK
Protein Name PDZ binding kinase
RefSeq NM_018492.2
Length of RefSeq (bp) 1899
Chromosome 8p21.2
Reference DDBJ accession
UniGene Hs.104741

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096N07 pGCAP10 GAGGGTTCgAATTGCAACGGCAgCTGCCGGGCgTATGTGTTGGTGCTaGAGGCNNNTGNN
RBdS007L12 pGCAP10 GAACGGCAGCTGCCGGGCGTATGTGTTGGTGCTAGAGGCAGCTGCAGGGTCTCGCTGGGG
RBdS014H24 pGCAP10 GGCAACGGCAGCTGCCGGGCGTATGTGTTGGTGCTAGAGGCAGCTGCAGGGTCTCGCTGG
RBdS022M03 pGCAP10 GGCGGTGAGGGTGGAGGGAAGGAGAGGGGGTGGCGCGGGGGACCGGGGAATGAAAGACAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl