Prev. |  KEGG KO K08865 > 

RIKEN DNA Bank Human Resource - PBK

Gene ID NCBI Gene 55872 |  KEGG hsa:55872
Gene Symbol PBK
Protein Name PDZ binding kinase
Synonyms CT84|HEL164|Nori-3|SPK|TOPK
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  PBK

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088471 IRAL021C23 pDNR-LIB BC015191 NM_018492 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005846 W01A014K06 pENTR-TOPO IRAL021C23 BC015191 NM_018492  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238719 ARiS096N07 pGCAP10 NM_018492.2  
GAGGGTTCgAATTGCAACGGCAgCTGCCGGGCgTATGTGTTGGTGCTaGAGGCNNNTGNN
HKR403076 RBdS007L12 pGCAP10 NM_018492.2  
GAACGGCAGCTGCCGGGCGTATGTGTTGGTGCTAGAGGCAGCTGCAGGGTCTCGCTGGGG
HKR405792 RBdS014H24 pGCAP10 NM_018492.2  
GGCAACGGCAGCTGCCGGGCGTATGTGTTGGTGCTAGAGGCAGCTGCAGGGTCTCGCTGG
HKR409091 RBdS022M03 pGCAP10 NM_018492.2  
GGCGGTGAGGGTGGAGGGAAGGAGAGGGGGTGGCGCGGGGGACCGGGGAATGAAAGACAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl