Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01865

HP ID(1) HP01865
Gene ID(2) 9777
Gene Symbol finder TM9SF4
Protein Name transmembrane 9 superfamily protein member 4
RefSeq NM_014742.3
Length of RefSeq (bp) 3996
Chromosome 20q11.21
Reference DDBJ accession
UniGene Hs.654665

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe46E07 pKA1U5 GGGATCCAAGATGGCGACGGCGATGGATTGGTTGCCGTGGTCTTTACTGCTTTTCTCCCT
ARe66E04 pKA1U5 GGGATCCAAGATGGCGACGGCGATGGATTGGTTGCCGTGGTCTTTACTGCTTTTCTCCCT
ARiS122A06 pGCAP10 GGGATCCAAGATGGCGACGGCGATGGATTGGTTGCCGTGGTCTTTACTGCTTTTCTCCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl