Prev. |  KEGG KO K17086 > 

RIKEN DNA Bank Human Resource - TM9SF4

Gene ID NCBI Gene 9777 |  KEGG hsa:9777
Gene Symbol TM9SF4
Protein Name transmembrane 9 superfamily member 4
Synonyms dJ836N17.2
Ortholog resource in our bank

  TM9SF4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090371 IRAL025P11 pOTB7 BC022850 NM_014742
HGY096314 IRAL040N02 pOTB7 BC021107 NM_014742 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058503 ARe46E07 pKA1U5 NM_014742.3  
GGGATCCAAGATGGCGACGGCGATGGATTGGTTGCCGTGGTCTTTACTGCTTTTCTCCCT
HKR066500 ARe66E04 pKA1U5 NM_014742.3  
GGGATCCAAGATGGCGACGGCGATGGATTGGTTGCCGTGGTCTTTACTGCTTTTCTCCCT
HKR248806 ARiS122A06 pGCAP10 NM_014742.3  
GGGATCCAAGATGGCGACGGCGATGGATTGGTTGCCGTGGTCTTTACTGCTTTTCTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl