Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01862

HP ID(1) HP01862
Gene ID(2) 64114
Gene Symbol finder TMBIM1
Protein Name transmembrane BAX inhibitor motif containing 1
RefSeq NM_022152.4
Length of RefSeq (bp) 2375
Chromosome 2p24.3-p24.1
Reference DDBJ accession
UniGene Hs.591605

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe07F08 pKA1U5 GACTCCGAGGCCAGGAACGCTCCGTCTGGAACGGCGNAGGATCCCAGCAGCTGGGGTTCC
ARi43F01 pGCAP10 GGAGGCCGGCGCGACGGGGCGGGGCGCGGAGCCCCAGCCGAGCCTAGCCCTGCCCGGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl