Prev. |  KEGG KO K06890 > 

RIKEN DNA Bank Human Resource - TMBIM1

Gene ID NCBI Gene 64114 |  KEGG hsa:64114
Gene Symbol TMBIM1
Protein Name transmembrane BAX inhibitor motif containing 1
Synonyms LFG3|MST100|MSTP100|PP1201|RECS1
Ortholog resource in our bank

  TMBIM1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005873 IRAK014L09 pCMV-SPORT6 BC013428 NM_022152 Full/var
HGX008126 IRAK020F06 pCMV-SPORT6 BC026693 NM_022152 Full/var
HGY012823 IRAK032A23 pBluescriptR BC026348 NM_022152 Full
HGY089956 IRAL024O20 pOTB7 BC007980 NM_022152 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042928 ARe07F08 pKA1U5 NM_022152.4  
GACTCCGAGGCCAGGAACGCTCCGTCTGGAACGGCGNAGGATCCCAGCAGCTGGGGTTCC
HKR177321 ARi43F01 pGCAP10 NM_022152.4  
GGAGGCCGGCGCGACGGGGCGGGGCGCGGAGCCCCAGCCGAGCCTAGCCCTGCCCGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl