Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01815

HP ID(1) HP01815
Gene ID(2) 9097
Gene Symbol finder USP14
Protein Name ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
RefSeq NM_005151.3
Length of RefSeq (bp) 4156
Chromosome 18p11.32
Reference DDBJ accession
UniGene Hs.464416

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb19B07 pKA1U5 ATCCTGTCGTCGCACCGAAGCCGCCGCCACCACCGCGCCTCCGCCTCGGCCGCCGCCGCA
RBd09H01 pGCAP10 CGCCTCGGCCGCCGCCGCAGCTGCTCCTGGTCCCCGTCCCTTTGCCGCCCTCGTCAGGCC
RBd47H06 pGCAP10 ACCACCGCGCCTCCGCCTCGGCCGCCGCCGCAGCTGCTCCTGGTCCCCGTCCCTTTGCCG
RBdS015N14 pGCAP10 GGANNNTNNTCGCACCGAAGCCGCCGCCACCACCGCGCCTCCGCCTCGGCCGCCGCCGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl