Prev. |  KEGG KO K11843 > 

RIKEN DNA Bank Human Resource - USP14

Gene ID NCBI Gene 9097 |  KEGG hsa:9097
Gene Symbol USP14
Protein Name ubiquitin specific peptidase 14
Synonyms TGT
Ortholog resource in our bank

  USP14

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083582 IRAL008P22 pOTB7 BC003556 NM_005151 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR327631 RBb19B07 pKA1U5 NM_005151.3  
ATCCTGTCGTCGCACCGAAGCCGCCGCCACCACCGCGCCTCCGCCTCGGCCGCCGCCGCA
HKR363769 RBd09H01 pGCAP10 NM_005151.3  
CGCCTCGGCCGCCGCCGCAGCTGCTCCTGGTCCCCGTCCCTTTGCCGCCCTCGTCAGGCC
HKR378974 RBd47H06 pGCAP10 NM_005151.3  
ACCACCGCGCCTCCGCCTCGGCCGCCGCCGCAGCTGCTCCTGGTCCCCGTCCCTTTGCCG
HKR406326 RBdS015N14 pGCAP10 NM_005151.3  
GGANNNTNNTCGCACCGAAGCCGCCGCCACCACCGCGCCTCCGCCTCGGCCGCCGCCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl