Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01812

HP ID(1) HP01812
Gene ID(2) 10438
Gene Symbol finder C1D
Protein Name nuclear DNA-binding protein
RefSeq NM_006333.2
Length of RefSeq (bp) 1200
Chromosome 2p13-p12
Reference DDBJ accession
UniGene Hs.602900

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe50B01 pKA1U5 GGTCATCGTTGCCCGACCGCTTTCCGGGAGACTGGAGTCGAAGGCCGTGAGCCAGTGTTT
ARiS118B18 pGCAP10 GATCGTTGCCCGACCGCTTTCCGGGAGACTGGAGTCGAAGGCCGTGAGTCAGCCATAATG
RBdS051L18 pGCAP10 GGGGCAGANCCGGCGCGTCATTGTCGTCATCGTTGCCCGACCGCTTTCCGGGAGACTGGA
RBdS105P01 pGCAP10 GGCTTTCCGGGAGACTGGAGTCGAAGGCCGTGAGGTATTTTTCTAAGCCAGTGTTTTAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl