Prev. |  KEGG KO K12592 > 

RIKEN DNA Bank Human Resource - C1D

Gene ID NCBI Gene 10438 |  KEGG hsa:10438
Gene Symbol C1D
Protein Name C1D nuclear receptor corepressor
Synonyms LRP1|Rrp47|SUN-CoR|SUNCOR|hC1D
Ortholog resource in our bank

  C1D

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006002 IRAK015A02 pCMV-SPORT6 BC016284 NM_173177 Full
HGY086671 IRAL016L07 pDNR-LIB BC005235 NM_173177 Full
HGY088433 IRAL021B09 pDNR-LIB BC009589 NM_173177 Full
HGY088715 IRAL021N03 pDNR-LIB BC009584 NM_173177 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060025 ARe50B01 pKA1U5 NM_006333.2  
GGTCATCGTTGCCCGACCGCTTTCCGGGAGACTGGAGTCGAAGGCCGTGAGCCAGTGTTT
HKR247242 ARiS118B18 pGCAP10 NM_006333.2  
GATCGTTGCCCGACCGCTTTCCGGGAGACTGGAGTCGAAGGCCGTGAGTCAGCCATAATG
HKR420682 RBdS051L18 pGCAP10 NM_006333.2  
GGGGCAGANCCGGCGCGTCATTGTCGTCATCGTTGCCCGACCGCTTTCCGGGAGACTGGA
HKR442361 RBdS105P01 pGCAP10 NM_006333.2  
GGCTTTCCGGGAGACTGGAGTCGAAGGCCGTGAGGTATTTTTCTAAGCCAGTGTTTTAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl