Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01796

HP ID(1) HP01796
Gene ID(2) 4717
Gene Symbol finder NDUFC1
Protein Name NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa
RefSeq NM_002494.2
Length of RefSeq (bp) 418
Chromosome 4q28.2-q31.1
Reference DDBJ accession
UniGene Hs.84549

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191H12 pGCAP10 GACGCAAGATGGCGCCGTCCGCCTTGCTGCGTCCCCTTTCCCGGCTGCTGGCCCCCGCCA
ARiS198F22 pGCAP10 NCAACGGAGGCAGAGGAGCTGAAGACTCCAGTATGCAACTGACTACAAGGAGACAGAAGG
RBb31B02 pGCAP1
RBdS070H12 pGCAP10 GGTTGCCAACTCGGAGAGACTGAGCTGGGCCACGCAAGATGGCGCCGTCCGCCTTGCTGC
RBdS187D17 pGCAP10 GGCTGGGCCACGCAAGATGGCGCCGTCCGCCTTGCTGCGTCCCCTTTCCCGGCTGCTGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl