Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFC1

Gene ID (NCBI) 4717
Gene Symbol NDUFC1
Protein Name NADH:ubiquinone oxidoreductase subunit C1
Synonyms KFYI
Databases KEGG hsa:4717 |  NCBI Gene 4717
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03967)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR276580 ARiS191H12 pGCAP10 NM_002494.2  
GACGCAAGATGGCGCCGTCCGCCTTGCTGCGTCCCCTTTCCCGGCTGCTGGCCCCCGCCA
HKR279342 ARiS198F22 pGCAP10 NM_002494.2  
NCAACGGAGGCAGAGGAGCTGAAGACTCCAGTATGCAACTGACTACAAGGAGACAGAAGG
HKR332426 RBb31B02 pGCAP1 NM_002494.2  
HKR428180 RBdS070H12 pGCAP10 NM_002494.2  
GGTTGCCAACTCGGAGAGACTGAGCTGGGCCACGCAAGATGGCGCCGTCCGCCTTGCTGC
HKR474889 RBdS187D17 pGCAP10 NM_002494.2  
GGCTGGGCCACGCAAGATGGCGCCGTCCGCCTTGCTGCGTCCCCTTTCCCGGCTGCTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl