Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01795

HP ID(1) HP01795
Gene ID(2) 5355
Gene Symbol finder PLP2
Protein Name proteolipid protein 2 (colonic epithelium-enriched)
RefSeq NM_002668.1
Length of RefSeq (bp) 945
Chromosome Xp11.23
Reference DDBJ accession
UniGene Hs.77422

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe47B06 pKA1U5 GCTTCCCGGCCAGACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAGC
ARe63E11 pKA1U5 GCTCCTTCGCCCCGGGGCCCCCTTCCCGGCCAGACGGCGGGCAAGACAGCTGGGTGTACA
ARi09C03 pGCAP10 GAGACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAGCAAGTGAGCAG
ARiS023C12 pGCAP10 GCTCCTTCGCCCCGGGGCCCCCTTCCCGGCCAGACGGCGGGCAAGACAGCTGGGTGTACA
ARiS122F12 pGCAP10 GCCTTCCCGGCCAGACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAG
ARiS191D19 pGCAP10 GCTTCCCGGCCAGACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAGC
ARiS198E13 pGCAP10 ACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAGCAAGTGAGCAGATC
RBd09H02 pGCAP10 GAGACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAGCAAGTGAGCAG
RBd25G12 pGCAP10 GAGACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAGCAAGTGAGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl