Prev. | 

RIKEN DNA Bank Human Resource - PLP2

Gene ID NCBI Gene 5355 |  KEGG hsa:5355
Gene Symbol PLP2
Protein Name proteolipid protein 2
Synonyms A4|A4LSB
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058830 ARe47B06 pKA1U5 NM_002668.1  
GCTTCCCGGCCAGACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAGC
HKR065307 ARe63E11 pKA1U5 NM_002668.1  
GCTCCTTCGCCCCGGGGCCCCCTTCCCGGCCAGACGGCGGGCAAGACAGCTGGGTGTACA
HKR163651 ARi09C03 pGCAP10 NM_002668.1  
GAGACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAGCAAGTGAGCAG
HKR209260 ARiS023C12 pGCAP10 NM_002668.1  
GCTCCTTCGCCCCGGGGCCCCCTTCCCGGCCAGACGGCGGGCAAGACAGCTGGGTGTACA
HKR248932 ARiS122F12 pGCAP10 NM_002668.1  
GCCTTCCCGGCCAGACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAG
HKR276491 ARiS191D19 pGCAP10 NM_002668.1  
GCTTCCCGGCCAGACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAGC
HKR279309 ARiS198E13 pGCAP10 NM_002668.1  
ACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAGCAAGTGAGCAGATC
HKR363770 RBd09H02 pGCAP10 NM_002668.1  
GAGACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAGCAAGTGAGCAG
HKR370156 RBd25G12 pGCAP10 NM_002668.1  
GAGACGGCGGGCAAGACAGCTGGGTGTACAGCGTCCTCGAAACCACGAGCAAGTGAGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl