Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01734

HP ID(1) HP01734
Gene ID(2) 5763
Gene Symbol finder PTMS
Protein Name parathymosin
RefSeq NM_002824.4
Length of RefSeq (bp) 1150
Chromosome 12p13
Reference DDBJ accession
UniGene Hs.504613

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe12G11 pKA1U5 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
ARe16E10 pKA1U5 GCTCTTCCAGAGACCCAGCTTGCCGAGCGGCCGCCGCTGCCGCTGTCGCCGCCGCCGCCG
ARe20C01 pKA1U5 GGCCCTTCCGCCCGCCCTCCGGACGGCCGCAGCCCNTGCGGGTCTCCGCATCCAGACCCA
ARe25B12 pKA1U5 GGGGTTCCCTTCCCGGGGGCGGCAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGC
ARe56G07 pKA1U5 ATCCTGCGGACCCAGCTTGCCGAGNGGNCGCCCCNTNANNGGGTCGCCGCCGCCGCCGCC
ARe73D10 pKA1U5 GGGCAGCGGCTGGTCGGCGGCAGCTCTGCTGGCGCTNGGGCGGCGAGCCCGGGATCGAGC
ARi03G02 pGCAP10 GCTTTTTCGGCCGGNCCCCATGGAGGCGCAGGGGAAACTGAANTGCTTCGATGCCTCCCC
ARi09C05 pGCAP10 GAGACCCAGCTTGCCGAGCGGCCGCCGCTGCCGCTGTCGCCGCCGCCGCCGCCACCGCGC
ARi38F01 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
ARi42D05 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
ARi63A05 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
ARiS055M15 pGCAP10 TGGAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCT
ARiS109B11 pGCAP10 TGACCGCCCTTCCGCCCGCCCTCCGGACGGCCGCAGCCCTGCGGGTCTCCGCTCCAGACN
RBb01A07 pKA1U5 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCNNNGGGAGGAGAGCCCNGGATCAGAGCT
RBb07E07 pKA1U5 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBb08F09 pKA1U5 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBb35G09 pGCAP1 GAGCGGCTGGTTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTA
RBb54A04 pGCAP1 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBb64C01 pGCAP1 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBb64C02 pGCAP1 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBb68A04 pGCAP1 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBd11F08 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBd20D12 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBd41C10 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBd43G01 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBd44B10 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBd60A04 pGCAP10 GGCCTCTTCCAGAGACCCAGCTTGCCGAGCGGCCGCCGCTGCCGCTGTCGCCGCCGCCGC
RBd79G04 pGCAP10 GGGCAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGC
RBd99A10 pGCAP10 GTCCCACCTCACCTTGGGTCTTGGGGAAGGAGGTGTTTGGTCTCAACCCCTTCATGGCCC
RBdS022B07 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBdS022G17 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBdS040E22 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBdS040P14 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBdS051E24 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBdS083J15 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBdS132C08 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCNAGCTAC
RBdS154K11 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBdS177C06 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
RBdS187B23 pGCAP10 TGAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTA
RBdS187P12 pGCAP10 GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl