Prev. | 

RIKEN DNA Bank Human Resource - PTMS

Gene ID NCBI Gene 5763 |  KEGG hsa:5763
Gene Symbol PTMS
Protein Name parathymosin
Synonyms ParaT
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005923 IRAK014N11 pCMV-SPORT6 BC017025 NM_002824 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044955 ARe12G11 pKA1U5 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR046506 ARe16E10 pKA1U5 NM_002824.4  
GCTCTTCCAGAGACCCAGCTTGCCGAGCGGCCGCCGCTGCCGCTGTCGCCGCCGCCGCCG
HKR048049 ARe20C01 pKA1U5 NM_002824.4  
GGCCCTTCCGCCCGCCCTCCGGACGGCCGCAGCCCNTGCGGGTCTCCGCATCCAGACCCA
HKR050036 ARe25B12 pKA1U5 NM_002824.4  
GGGGTTCCCTTCCCGGGGGCGGCAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGC
HKR062551 ARe56G07 pKA1U5 NM_002824.4  
ATCCTGCGGACCCAGCTTGCCGAGNGGNCGCCCCNTNANNGGGTCGCCGCCGCCGCCGCC
HKR069282 ARe73D10 pKA1U5 NM_002824.4  
GGGCAGCGGCTGGTCGGCGGCAGCTCTGCTGGCGCTNGGGCGGCGAGCCCGGGATCGAGC
HKR163653 ARi09C05 pGCAP10 NM_002824.4  
GAGACCCAGCTTGCCGAGCGGCCGCCGCTGCCGCTGTCGCCGCCGCCGCCGCCACCGCGC
HKR175321 ARi38F01 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR176877 ARi42D05 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR185205 ARi63A05 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR222303 ARiS055M15 pGCAP10 NM_002824.4  
TGGAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCT
HKR243635 ARiS109B11 pGCAP10 NM_002824.4  
TGACCGCCCTTCCGCCCGCCCTCCGGACGGCCGCAGCCCTGCGGGTCTCCGCTCCAGACN
HKR320407 RBb01A07 pKA1U5 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCNNNGGGAGGAGAGCCCNGGATCAGAGCT
HKR322903 RBb07E07 pKA1U5 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR323329 RBb08F09 pKA1U5 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR334153 RBb35G09 pGCAP1 NM_002824.4  
GAGCGGCTGGTTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTA
HKR341604 RBb54A04 pGCAP1 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR345649 RBb64C01 pGCAP1 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR345650 RBb64C02 pGCAP1 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR347204 RBb68A04 pGCAP1 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR364528 RBd11F08 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR368084 RBd20D12 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR376458 RBd41C10 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR377345 RBd43G01 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR377634 RBd44B10 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR384004 RBd60A04 pGCAP10 NM_002824.4  
GGCCTCTTCCAGAGACCCAGCTTGCCGAGCGGCCGCCGCTGCCGCTGTCGCCGCCGCCGC
HKR391748 RBd79G04 pGCAP10 NM_002824.4  
GGGCAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGC
HKR399610 RBd99A10 pGCAP10 NM_002824.4  
GTCCCACCTCACCTTGGGTCTTGGGGAAGGAGGTGTTTGGTCTCAACCCCTTCATGGCCC
HKR408831 RBdS022B07 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR408961 RBdS022G17 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR416118 RBdS040E22 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR416374 RBdS040P14 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR420520 RBdS051E24 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR433431 RBdS083J15 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR452856 RBdS132C08 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCNAGCTAC
HKR461851 RBdS154K11 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR470854 RBdS177C06 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC
HKR474847 RBdS187B23 pGCAP10 NM_002824.4  
TGAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTA
HKR475172 RBdS187P12 pGCAP10 NM_002824.4  
GAGCGGCTGGTCGGCGGCAGCTCTGCTGGTGCGGGGGCGGCGAGCCCGGGATCGAGCTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl