Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01728

HP ID(1) HP01728
Gene ID(2) 7384
Gene Symbol finder UQCRC1
Protein Name ubiquinol-cytochrome c reductase core protein I
RefSeq NM_003365.2
Length of RefSeq (bp) 1636
Chromosome 3p21.3
Reference DDBJ accession
UniGene Hs.119251

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe26C11 pKA1U5 GGCAACAGGGCCGACTGCAGCTGGAAGATGGCGGCGTCCGTGGTCTGTCGGGCCGCTACC
ARe71E01 pKA1U5 GGCAACAGGGCCGACTGCAGCTGGAAGATGGCGGCGTCCGTGGTCTGTCGGGCCGCTACC
ARi17F12 pGCAP10 GGCAACAGGGCCGACTGCAGCTGGAAGATGGCGGCGTCCGTGGTCTGTCGGGCCGCTACC
RBd52A05 pGCAP10 GAGGGCCGACTGCAGCTGGAAGATGGCGGCGTCCGTGGTCTGTCGGGCCGCTACCGCCGG
RBd79D03 pGCAP10 GGCAACAGGGCCGACTGCAGCTGGAAGATGGCGGCGTCCGTGGTCTGTCGGGCCGCTACC
RBdS105L12 pGCAP10 GGCCCAGTCTACGCTTGCGCGGCGCAACAGGGCCGACTGCAGCTGGAAGATGGCGGCGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl