Prev. |  KEGG KO K00414 > 

RIKEN DNA Bank Human Resource - UQCRC1

Gene ID NCBI Gene 7384 |  KEGG hsa:7384
Gene Symbol UQCRC1
Protein Name ubiquinol-cytochrome c reductase core protein 1
Synonyms D3S3191|QCR1|UQCR1
Ortholog resources KEGG ortholog (KEGG orthology K00414) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088763 IRAL021P03 pDNR-LIB BC009586 NM_003365 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050459 ARe26C11 pKA1U5 NM_003365.2  
GGCAACAGGGCCGACTGCAGCTGGAAGATGGCGGCGTCCGTGGTCTGTCGGGCCGCTACC
HKR068497 ARe71E01 pKA1U5 NM_003365.2  
GGCAACAGGGCCGACTGCAGCTGGAAGATGGCGGCGTCCGTGGTCTGTCGGGCCGCTACC
HKR166932 ARi17F12 pGCAP10 NM_003365.2  
GGCAACAGGGCCGACTGCAGCTGGAAGATGGCGGCGTCCGTGGTCTGTCGGGCCGCTACC
HKR380805 RBd52A05 pGCAP10 NM_003365.2  
GAGGGCCGACTGCAGCTGGAAGATGGCGGCGTCCGTGGTCTGTCGGGCCGCTACCGCCGG
HKR391675 RBd79D03 pGCAP10 NM_003365.2  
GGCAACAGGGCCGACTGCAGCTGGAAGATGGCGGCGTCCGTGGTCTGTCGGGCCGCTACC
HKR442276 RBdS105L12 pGCAP10 NM_003365.2  
GGCCCAGTCTACGCTTGCGCGGCGCAACAGGGCCGACTGCAGCTGGAAGATGGCGGCGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl