Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01713

HP ID(1) HP01713
Gene ID(2) 7353
Gene Symbol finder UFD1L
Protein Name ubiquitin fusion degradation 1-like
RefSeq NM_005659.5
Length of RefSeq (bp) 1534
Chromosome 22q11.21
Reference DDBJ accession
UniGene Hs.474213

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05B01 pKA1U5 GNGCGCCGCNGCAGCGGCAGCGGTNGCTGGNCCCANTGNACGGCGGGGTTTCATTCGNTG
ARe32B10 pKA1U5 GTTGGCGCGGCGGCAGCGGCAGCGGCGGCTGGGAGAGCGGTCGGCGGGGTTTCTTCGTTG
ARiS008J02 pGCAP10 GGCATTGCCTGAGAGGAGCGGAGTCTGCCAGGTGGTGTCCATCATGTTCTCTTTCAACAT
ARiS191E18 pGCAP10 GGGCGCGGCGGCAGCGGCAGCGGCGGCTGGGAGAGCGGTCGGCGGGGTTTCTTCGTTGCA
RBb67F05 pGCAP1 TGGTTGCGCGCGGCGTGCGGCGGCAGCGGCGGCTGGGAGAGCGGTCGGCGGGGTTTCTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl