Prev. |  KEGG KO K14016 > 

RIKEN DNA Bank Human Resource - UFD1

Gene ID NCBI Gene 7353 |  KEGG hsa:7353
Gene Symbol UFD1
Protein Name ubiquitin recognition factor in ER associated degradation 1
Synonyms UFD1L
Ortholog resources KEGG ortholog (KEGG orthology K14016) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082872 IRAL007C24 pOTB7 BC001049 NM_005659 Full
HGY087447 IRAL018K07 pOTB7 BC005087 NM_005659 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042025 ARe05B01 pKA1U5 NM_005659.5  
GNGCGCCGCNGCAGCGGCAGCGGTNGCTGGNCCCANTGNACGGCGGGGTTTCATTCGNTG
HKR052834 ARe32B10 pKA1U5 NM_005659.5  
GTTGGCGCGGCGGCAGCGGCAGCGGCGGCTGGGAGAGCGGTCGGCGGGGTTTCTTCGTTG
HKR203418 ARiS008J02 pGCAP10 NM_005659.5  
GGCATTGCCTGAGAGGAGCGGAGTCTGCCAGGTGGTGTCCATCATGTTCTCTTTCAACAT
HKR276514 ARiS191E18 pGCAP10 NM_005659.5  
GGGCGCGGCGGCAGCGGCAGCGGCGGCTGGGAGAGCGGTCGGCGGGGTTTCTTCGTTGCA
HKR346925 RBb67F05 pGCAP1 NM_005659.5  
TGGTTGCGCGCGGCGTGCGGCGGCAGCGGCGGCTGGGAGAGCGGTCGGCGGGGTTTCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl