Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01708

HP ID(1) HP01708
Gene ID(2) 4718
Gene Symbol finder NDUFC2
Protein Name NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa
RefSeq NM_004549.4
Length of RefSeq (bp) 2498
Chromosome 11q14.1
Reference DDBJ accession
UniGene Hs.407860

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe61E04 pKA1U5 GGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGCCCNTTNAAGGTTTTCCTTGTAGATTCG
ARe65H12 pKA1U5 TGGCCCGTGAGTCCGGCGCGCAGAGGAGGAGCCCNNNAAAGACCGCTTAGGCCCGGGTAG
ARe86C01 pKA1U5 GAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTCGTGGTTTTCCTTGTAGTTCGTGG
ARe98C09 pKA1U5 GAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTC
ARi21B04 pGCAP10 ACGGTTTCTGCCGGATGAGGCCCGGAGCCTGCCCCCGCCCAAGCTGACCGACCCGCGGCT
ARiS096B16 pGCAP10 GGCCCGTGAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGT
RBb21D11 pKA1U5 ATCCTGGGAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGT
RBb27D08 pGCAP1 GAGCGCGGGCGGACGAGCAAAGTGAAACTTAGTAGCCCGGAACTTCGCGTGCCGGGTTCC
RBb32B01 pGCAP1 GAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTC
RBb44D02 pGCAP1
RBd09H12 pGCAP10 GGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTCG
RBd12B04 pGCAP10 GGTGCCCGTGAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTA
RBd35H08 pGCAP10 GAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTC
RBdS075F24 pGCAP10 GGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTCGTGGTTTTCCTTGTAGTTCGT
RBdS081A12 pGCAP10 GGAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGT
RBdS104A03 pGCAP10 GGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTCGTGGTTTTCCTTGTAGTTCGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl