Prev. |  KEGG KO K03968 > 

RIKEN DNA Bank Human Resource - NDUFC2

Gene ID NCBI Gene 4718 |  KEGG hsa:4718
Gene Symbol NDUFC2
Protein Name NADH:ubiquinone oxidoreductase subunit C2
Synonyms B14.5b|CI-B14.5b|HLC-1|NADHDH2
Ortholog resources KEGG ortholog (KEGG orthology K03968) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081504 IRAL003M16 pOTB7 BC007323 NM_004549

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064500 ARe61E04 pKA1U5 NM_004549.4  
GGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGCCCNTTNAAGGTTTTCCTTGTAGATTCG
HKR066180 ARe65H12 pKA1U5 NM_004549.4  
TGGCCCGTGAGTCCGGCGCGCAGAGGAGGAGCCCNNNAAAGACCGCTTAGGCCCGGGTAG
HKR074449 ARe86C01 pKA1U5 NM_004549.4  
GAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTCGTGGTTTTCCTTGTAGTTCGTGG
HKR079257 ARe98C09 pKA1U5 NM_004549.4  
GAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTC
HKR168428 ARi21B04 pGCAP10 NM_004549.4  
ACGGTTTCTGCCGGATGAGGCCCGGAGCCTGCCCCCGCCCAAGCTGACCGACCCGCGGCT
HKR238440 ARiS096B16 pGCAP10 NM_004549.4  
GGCCCGTGAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGT
HKR328483 RBb21D11 pKA1U5 NM_004549.4  
ATCCTGGGAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGT
HKR330880 RBb27D08 pGCAP1 NM_004549.4  
GAGCGCGGGCGGACGAGCAAAGTGAAACTTAGTAGCCCGGAACTTCGCGTGCCGGGTTCC
HKR332825 RBb32B01 pGCAP1 NM_004549.4  
GAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTC
HKR337674 RBb44D02 pGCAP1 NM_004549.4  
HKR363780 RBd09H12 pGCAP10 NM_004549.4  
GGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTCG
HKR364828 RBd12B04 pGCAP10 NM_004549.4  
GGTGCCCGTGAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTA
HKR374176 RBd35H08 pGCAP10 NM_004549.4  
GAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTC
HKR430144 RBdS075F24 pGCAP10 NM_004549.4  
GGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTCGTGGTTTTCCTTGTAGTTCGT
HKR432412 RBdS081A12 pGCAP10 NM_004549.4  
GGAGTCCGGCGCGCAGAGGAGGAGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGT
HKR441603 RBdS104A03 pGCAP10 NM_004549.4  
GGGAGAAAGCTGACCGCTTAGGCCCGGGTAGTGGTCGTCGTGGTTTTCCTTGTAGTTCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl