Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01689

HP ID(1) HP01689
Gene ID(2) 124641
Gene Symbol finder OVCA2
Protein Name candidate tumor suppressor in ovarian cancer 2
RefSeq NM_080822.2
Length of RefSeq (bp) 1076
Chromosome 17p13.3
Reference DDBJ accession
UniGene Hs.513856

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb03B05 pKA1U5 GGGGCATAATGGCCGCGCAGCGACCCCTGCGGGTCCTGTGCCTGGCGGGCTTCCGGCAGA
RBb43H10 pGCAP1 ATTTCCTGGCAGCAGCCCTACCCGATGGACTTCTACGCTGGCAGCTCCTTGGGGCCCTGG
RBd59C01 pGCAP10 GGCTCCTTGCCGGGCATAATGGCCGCGCAGAGACCCCTGCGGGTCCTGTGCCTGGCGGGC
RBd61H03 pGCAP10 GACATTTCCTGGCAGCAGCCCTACCCGATGGACTTCTACGCTGGCAGCTCCTTGGGGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl