Prev. | 

RIKEN DNA Bank Human Resource - OVCA2

Gene ID NCBI Gene 124641 |  KEGG hsa:124641
Gene Symbol OVCA2
Protein Name OVCA2 serine hydrolase domain containing
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033828 IRAK084J12 pCMV-SPORT6 BC041170 NM_080822 Full
HGX035970 IRAK089P10 pCMV-SPORT6 BC040696 NM_080822 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR321229 RBb03B05 pKA1U5 NM_080822.2  
GGGGCATAATGGCCGCGCAGCGACCCCTGCGGGTCCTGTGCCTGGCGGGCTTCCGGCAGA
HKR337378 RBb43H10 pGCAP1 NM_080822.2  
ATTTCCTGGCAGCAGCCCTACCCGATGGACTTCTACGCTGGCAGCTCCTTGGGGCCCTGG
HKR383649 RBd59C01 pGCAP10 NM_080822.2  
GGCTCCTTGCCGGGCATAATGGCCGCGCAGAGACCCCTGCGGGTCCTGTGCCTGGCGGGC
HKR384571 RBd61H03 pGCAP10 NM_080822.2  
GACATTTCCTGGCAGCAGCCCTACCCGATGGACTTCTACGCTGGCAGCTCCTTGGGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl