Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01672

HP ID(1) HP01672
Gene ID(2) 10726
Gene Symbol finder NUDC
Protein Name nuclear distribution gene C homolog (A. nidulans)
RefSeq NM_006600.2
Length of RefSeq (bp) 1397
Chromosome 1p35-p34
Reference DDBJ accession
UniGene Hs.263812

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe49C11 pKA1U5 GGGCTCCGCTGCGGAAGGCGGACGACTAGAGTCGTTGGGCCCGGCGCGAACCGCAGGAGC
ARe71E06 pKA1U5 GAGAGAGCGCGGGACTAGAGTGCAGAGCTCCGGGANNTGGATCGGAGCCGGCGCGATGGG
ARe81D11 pKA1U5 ATCCTGGGACTAGAGTCGTTGGGCCCGGCGCGACCCGCAGGAGCGTAGAGAGCGCGGGAC
ARiS150E18 pGCAP10 GGAAGGNNGACNANTANNGNCNTTGGGCCCGGCGCGACCCGCAGGAGCGTAGAGAGCGCG
RBd04E05 pGCAP10 GGCGTGTTTCCGGCTCCGCTGCGGAAGGCGGACGACTAGAGTCGTTGGGCCCGGCGCGAC
RBd08B02 pGCAP10 GAGGGGGACGACTAGAGTCTTTGGGCCCGGCGCGACCCGCAGGAGCGTACACAGCGCGGG
RBd44G09 pGCAP10 GGCGGAAGGCGGACGACTAGAGTCGTTGGGCCCGGCGCGACCCGCAGGAGCGTAGAGAGC
RBd51H03 pGCAP10 GGGCGCGACCCGCAGGAGCGTAGAGAGCGCGGGACTAGAGTGCAGAGCTCCGGGACGTGG
RBd52E04 pGCAP10 GGGCGCGACCCGCAGGAGCGTAGAGAGCGCGGGACTAGAGTGCAGAGCTCCGGGACGTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl