Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUDC

Gene ID (NCBI) 10726
Gene Symbol NUDC
Protein Name nudC nuclear distribution protein
Synonyms HNUDC|MNUDC|NPD011
Databases KEGG link 01 |  NCBI Gene link 01


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04482 SEREX clone BRC-Co-45 #1 SEREX clone BRC-Co-45 #1

RDB_hum_160722.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008811 IRAK022A11 pCMV-SPORT6 BC015153 NM_006600 Full
HGY080576 IRAL001H08 pOTB7 BC002399 NM_006600 Full
HGY083742 IRAL009F22 pOTB7 BC003132 NM_006600 Full
HGY087490 IRAL018M02 pOTB7 BC006147 NM_006600 Full
HGY089048 IRAL022K08 pOTB7 BC007280 NM_006600
HGY096284 IRAL040L20 pOTB7 BC021139 NM_006600 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE014741 W01A036O05 pENTR-TOPO IRAL001H08 BC002399 NM_006600

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR059659 ARe49C11 pKA1U5 NM_006600.2
GGGCTCCGCTGCGGAAGGCGGACGACTAGAGTCGTTGGGCCCGGCGCGAACCGCAGGAGC
HKR068502 ARe71E06 pKA1U5 NM_006600.2
GAGAGAGCGCGGGACTAGAGTGCAGAGCTCCGGGANNTGGATCGGAGCCGGCGCGATGGG
HKR072483 ARe81D11 pKA1U5 NM_006600.2
ATCCTGGGACTAGAGTCGTTGGGCCCGGCGCGACCCGCAGGAGCGTAGAGAGCGCGGGAC
HKR260114 ARiS150E18 pGCAP10 NM_006600.2
GGAAGGNNGACNANTANNGNCNTTGGGCCCGGCGCGACCCGCAGGAGCGTAGAGAGCGCG
HKR361701 RBd04E05 pGCAP10 NM_006600.2
GGCGTGTTTCCGGCTCCGCTGCGGAAGGCGGACGACTAGAGTCGTTGGGCCCGGCGCGAC
HKR363226 RBd08B02 pGCAP10 NM_006600.2
GAGGGGGACGACTAGAGTCTTTGGGCCCGGCGCGACCCGCAGGAGCGTACACAGCGCGGG
HKR377753 RBd44G09 pGCAP10 NM_006600.2
GGCGGAAGGCGGACGACTAGAGTCGTTGGGCCCGGCGCGACCCGCAGGAGCGTAGAGAGC
HKR380571 RBd51H03 pGCAP10 NM_006600.2
GGGCGCGACCCGCAGGAGCGTAGAGAGCGCGGGACTAGAGTGCAGAGCTCCGGGACGTGG
HKR380900 RBd52E04 pGCAP10 NM_006600.2
GGGCGCGACCCGCAGGAGCGTAGAGAGCGCGGGACTAGAGTGCAGAGCTCCGGGACGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl