Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01640

HP ID(1) HP01640
Gene ID(2) 126003
Gene Symbol finder TRAPPC5
Protein Name trafficking protein particle complex 5
RefSeq NM_174894.1
Length of RefSeq (bp) 814
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.432413

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe21E05 pKA1U5 GGTAAAGCAGCTCGGCCGAGCAGACTGCTGCGGTTCCTGGGTGGCGGCGGCATGGAGGCG
ARe82F09 pKA1U5 GGAGCAGACTGCTGCGGTTCCTGGGTGGCGGCGGCATGGAGGCGCGCTTCACGCGCGGGA
RBb07E08 pKA1U5
RBb62B06 pGCAP1
RBb66F11 pGCAP1 GAGCAGACTGCTGCGGTTCCTGGGTGGCGGCGGCATGGAGGCGCGCTTCACGCGCGGGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl