Prev. |  KEGG KO K20280 > 

RIKEN DNA Bank Human Resource - TRAPPC5

Gene ID NCBI Gene 126003 |  KEGG hsa:126003
Gene Symbol TRAPPC5
Protein Name trafficking protein particle complex 5
Synonyms TRS31
Ortholog resource in our bank

  TRAPPC5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY097726 IRAL044F06 pOTB7 BC042161

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE111231 M01C078B07 pDONR221 06-2_02-G04 BC042161 ENST00000317378  
HGE111279 M01C078D07 pDONR221 06-2_02-G04 BC042161 ENST00000317378  
HGE111327 M01C078F07 pDONR221 06-2_02-G04 BC042161 ENST00000317378  
HGE092032 M01C030B08 pDONR221 MGC04-H04 BC042161 ENST00000317378  
HGE092080 M01C030D08 pDONR221 MGC04-H04 BC042161 ENST00000317378  
HGE092128 M01C030F08 pDONR221 MGC04-H04 BC042161 ENST00000317378  
HGE092176 M01C030H08 pDONR221 MGC04-H04 BC042161 ENST00000317378  
HGE092224 M01C030J08 pDONR221 MGC04-H04 BC042161 ENST00000317378  
HGE092272 M01C030L08 pDONR221 MGC04-H04 BC042161 ENST00000317378  
HGE092320 M01C030N08 pDONR221 MGC04-H04 BC042161 ENST00000317378  
HGE092368 M01C030P08 pDONR221 MGC04-H04 BC042161 ENST00000317378  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048501 ARe21E05 pKA1U5 NM_174894.1  
GGTAAAGCAGCTCGGCCGAGCAGACTGCTGCGGTTCCTGGGTGGCGGCGGCATGGAGGCG
HKR072929 ARe82F09 pKA1U5 NM_174894.1  
GGAGCAGACTGCTGCGGTTCCTGGGTGGCGGCGGCATGGAGGCGCGCTTCACGCGCGGGA
HKR322904 RBb07E08 pKA1U5 NM_174894.1  
HKR344830 RBb62B06 pGCAP1 NM_174894.1  
HKR346531 RBb66F11 pGCAP1 NM_174894.1  
GAGCAGACTGCTGCGGTTCCTGGGTGGCGGCGGCATGGAGGCGCGCTTCACGCGCGGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl