Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01631

HP ID(1) HP01631
Gene ID(2) 9898
Gene Symbol finder UBAP2L
Protein Name ubiquitin associated protein 2-like
RefSeq NM_014847.3
Length of RefSeq (bp) 4006
Chromosome 1q21.3
Reference DDBJ accession
UniGene Hs.490551

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd11D09 pGCAP10 GAGTGTGGAGGAGACTGAGGTAAAGTTGGGAGCGCAGCGGCGTTGGCGGCGGCGGCGGCG
RBdS156M05 pGCAP10 GGGGAGCGCAGCGGCGTTGGCGGCGGCGGCGGCGGCAGCGGCAGCGCGGCGGGGCCGGTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl