Prev. | 

RIKEN DNA Bank Human Resource - UBAP2L

Gene ID NCBI Gene 9898 |  KEGG hsa:9898
Gene Symbol UBAP2L
Protein Name ubiquitin associated protein 2 like
Synonyms NICE-4|NICE4
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083730 IRAL009F10 pOTB7 BC003170 NM_014847

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097643 M01C044B19 pDONR221 MGC11-G10 BC003170 ENST00000368502  
HGE097691 M01C044D19 pDONR221 MGC11-G10 BC003170 ENST00000368502  
HGE097739 M01C044F19 pDONR221 MGC11-G10 BC003170 ENST00000368502  
HGE097787 M01C044H19 pDONR221 MGC11-G10 BC003170 ENST00000368502  
HGE097835 M01C044J19 pDONR221 MGC11-G10 BC003170 ENST00000368502  
HGE097883 M01C044L19 pDONR221 MGC11-G10 BC003170 ENST00000368502  
HGE097931 M01C044N19 pDONR221 MGC11-G10 BC003170 ENST00000368502  
HGE097979 M01C044P19 pDONR221 MGC11-G10 BC003170 ENST00000368502  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR364481 RBd11D09 pGCAP10 NM_014847.3  
GAGTGTGGAGGAGACTGAGGTAAAGTTGGGAGCGCAGCGGCGTTGGCGGCGGCGGCGGCG
HKR462693 RBdS156M05 pGCAP10 NM_014847.3  
GGGGAGCGCAGCGGCGTTGGCGGCGGCGGCGGCGGCAGCGGCAGCGCGGCGGGGCCGGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl