Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01623

HP ID(1) HP01623
Gene ID(2) 11051
Gene Symbol finder NUDT21
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 21
RefSeq NM_007006.2
Length of RefSeq (bp) 4407
Chromosome 16q13
Reference DDBJ accession
UniGene Hs.528834

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS088O16 pGCAP10 GGCGCTGTCCTGTTAATGGCGGGCAGTAGCCGCTGAGGGGATTGCAGATAACCGCTTCCC
RBb08D07 pKA1U5 GCTCTTGCGCTGTCCTGTTAATGGCGGGCAGCTAGCCGCTGAGGGGATTGCAGATAACCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl