DNA Bank Top |  KEGG KO K14397 > 

RIKEN DNA Bank Human Resource - NUDT21

Gene ID NCBI Gene 11051 |  KEGG hsa:11051
Gene Symbol NUDT21
Protein Name nudix hydrolase 21
Synonyms CFIM25|CPSF5

Link

Ortholog resource in our bank

  NUDT21


External database

human NUDT21

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB06999 pCMFlag_hsNUDT21 Expression vector of human NUDT21.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081700 IRAL004E04 pOTB7 BC001403 NM_007006 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235552 ARiS088O16 pGCAP10 NM_007006.2  
GGCGCTGTCCTGTTAATGGCGGGCAGTAGCCGCTGAGGGGATTGCAGATAACCGCTTCCC
HKR323279 RBb08D07 pKA1U5 NM_007006.2  
GCTCTTGCGCTGTCCTGTTAATGGCGGGCAGCTAGCCGCTGAGGGGATTGCAGATAACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl