Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUDT21

Gene ID (NCBI) 11051
Gene Symbol NUDT21
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 21
Synonyms CFIM25|CPSF5
Databases KEGG link 01 |  NCBI Gene link 01


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06999 pCMFlag_hsNUDT21 Expression vector of human NUDT21

RDB_hum_160722.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081700 IRAL004E04 pOTB7 BC001403 NM_007006 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR235552 ARiS088O16 pGCAP10 NM_007006.2
GGCGCTGTCCTGTTAATGGCGGGCAGTAGCCGCTGAGGGGATTGCAGATAACCGCTTCCC
HKR323279 RBb08D07 pKA1U5 NM_007006.2
GCTCTTGCGCTGTCCTGTTAATGGCGGGCAGCTAGCCGCTGAGGGGATTGCAGATAACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.06

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160825.pl