Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01604

HP ID(1) HP01604
Gene ID(2) 5547
Gene Symbol finder PRCP
Protein Name prolylcarboxypeptidase (angiotensinase C)
RefSeq NM_005040.2
Length of RefSeq (bp) 2161
Chromosome 11q14
Reference DDBJ accession
UniGene Hs.523936

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe16A07 pKA1U5 GACCCGCACTGCAGTCTCCAGCCTGAGCCATGGGCCGCCGAGCCCTCCTGCTCCTGCTTC
ARe16G05 pKA1U5 GCTTTTCTGGCGCCCTGGGCCACCATAGCCCTCCGGCCGGCCTTAAGGGCCCTCGGCAGC
ARe35F06 pKA1U5 GAGTCTCCAGCCTGAGCCATGGGCCGCCGAGCCCTCCTGCTCCTGCTTCTGTCTTTTCTG
ARf05D09 pKA1U5 GAGTCTCCAGCCTGAGCCATGGGCCGCCGAGCCCTCCTGCTCCTGCTTCTGTCTTTTCTG
ARi23E02 pGCAP10 GGCCCTCCCACCCGCACTGCAGTCTCCAGCCTGAGCCATGGGCCGCCGAGCCCTCCTGCT
ARiS150K06 pGCAP10 GTCCAGCCTGAGCCATGGGCCGCCGAGCCCTCCTGCTCCTGCTTCTGTCTTTTCTGGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl