Prev. |  KEGG KO K01285 > 

RIKEN DNA Bank Human Resource - PRCP

Gene ID NCBI Gene 5547 |  KEGG hsa:5547
Gene Symbol PRCP
Protein Name prolylcarboxypeptidase
Synonyms HUMPCP|PCP
Ortholog resources KEGG ortholog (KEGG orthology K01285) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083182 IRAL007P22 pOTB7 BC001500 NM_199418 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046407 ARe16A07 pKA1U5 NM_005040.2  
GACCCGCACTGCAGTCTCCAGCCTGAGCCATGGGCCGCCGAGCCCTCCTGCTCCTGCTTC
HKR046549 ARe16G05 pKA1U5 NM_005040.2  
GCTTTTCTGGCGCCCTGGGCCACCATAGCCCTCCGGCCGGCCTTAAGGGCCCTCGGCAGC
HKR054126 ARe35F06 pKA1U5 NM_005040.2  
GAGTCTCCAGCCTGAGCCATGGGCCGCCGAGCCCTCCTGCTCCTGCTTCTGTCTTTTCTG
HKR082081 ARf05D09 pKA1U5 NM_005040.2  
GAGTCTCCAGCCTGAGCCATGGGCCGCCGAGCCCTCCTGCTCCTGCTTCTGTCTTTTCTG
HKR169298 ARi23E02 pGCAP10 NM_005040.2  
GGCCCTCCCACCCGCACTGCAGTCTCCAGCCTGAGCCATGGGCCGCCGAGCCCTCCTGCT
HKR260246 ARiS150K06 pGCAP10 NM_005040.2  
GTCCAGCCTGAGCCATGGGCCGCCGAGCCCTCCTGCTCCTGCTTCTGTCTTTTCTGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl