Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01593

HP ID(1) HP01593
Gene ID(2) 6185
Gene Symbol finder RPN2
Protein Name ribophorin II
RefSeq NM_002951.3
Length of RefSeq (bp) 2538
Chromosome 20q12-q13.1
Reference DDBJ accession
UniGene Hs.370895

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe77H07 pKA1U5 GGGGACCTGCTCGGAGGAATGGCGCCGCCGGGCNTNTGNACTGTCTTCCTGTTGGCCCTG
ARf02D05 pKA1U5 GGCTCGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTGTTGGCCCTGACAATCA
ARi19G09 pGCAP10 CGTCCTCGGGAACTGCAAGGCCCTGTGAGCGGGAGGACTGGGATCCCGGCCGCGGCTGCT
ARi27A12 pGCAP10 GAGCCCGCGGCTCGGACTCCGGCGGGACCTGCTCGGAGGAATGGCGCCGCCGGGTTCAAG
ARi29E07 pGCAP10 GCTGCTCGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTGTTGGCCCTGACAAT
ARi32A09 pGCAP10 GGACTCCGGCGGGACCTGCTCGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTG
ARiS023D07 pGCAP10 GGCTCGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTGTTGGCCCTGACAATCA
ARiS088J23 pGCAP10 TGGCTCGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTGTTGGCCCTGACAATC
ARiS122O10 pGCAP10 GGGGACCTGCTCGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTGTTGGCCCTG
ARiS194E11 pGCAP10 GACTCCGGCGGGACCTGCTCGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTGT
ARiS194K12 pGCAP10 CGGCCGGNNNATGGCTCGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTGTTGG
ARiS194L03 pGCAP10 GACTCCGGCGGGACCTGCTCGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTGT
RBb72A12 pGCAP1 GGGGAACTGCAAGGCCCTGTGAGCGGGAGGACTGGGATCCCGGCCGCGGCTGCTGGAAGC
RBdS075P07 pGCAP10 TTGGGGACCTGCTCGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTGTTGGCCC
RBdS105A17 pGCAP10 GGCTCGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTGTTGGCCCTGACAATCA
RBdS132P06 pGCAP10 GGGAGGAATGGCGCCGCCGGGTTCAAGCACTGTCTTCCTGTTGGCCCTGACAATCATAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl