Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01590

HP ID(1) HP01590
Gene ID(2) 9804
Gene Symbol finder TOMM20
Protein Name translocase of outer mitochondrial membrane 20 homolog (yeast)
RefSeq NM_014765.2
Length of RefSeq (bp) 3407
Chromosome 1q42
Reference DDBJ accession
UniGene Hs.533192

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe86D02 pKA1U5 CTTTCTGTGTTCCTGGCCCGCGGCCGTCGGGTGTGAGCTGCGCCGACCGCTCTGAGGGTT
ARi08G02 pGCAP10 GCTTTTTCTTTCTGTGTTCCTGGCCCGCGGCCGTCGGGTGTGAGCTGCGCCGACCGCTCT
RBb33E04 pGCAP1 GGTGCTCGGCCTTTCTGTGTTCCTGGCCCGCGGCCGTCGGGTGTGAGCTGCGCCGACCGC
RBd19F02 pGCAP10 GCTTTCTGTGTTCCTGGCCCGCGGCCGTCGGGTGTGAGCTGCGCCGACCGCTCTGAGGGT
RBd81B08 pGCAP10 GGCTCGGCCTTTCTGTGTTCCTGGCCCGCGGCCGTCGGGTGTGAGCTGCGCCGACCGCTC
RBdS007L23 pGCAP10 GGCGGACGACCTCGAGGCCCTTAGTTGACTGGGACCGGAAGTGGCGTGTGCTCGGCCTTT
RBdS013O04 pGCAP10 GGCCGACCGCTCTGAGGGTTCGTGGCCCACCGCTCCTTCGCGGTCCCTGCCGCCACCGTC
RBdS156G16 pGCAP10 GCTTTTCTGTGTTCCTGGCCCGCGGCCGTCGGGTGTGAGCTGCGCCGACCGCTCTGAGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl