DNA Bank Top |  KEGG KO K17770 > 

RIKEN DNA Bank Human Resource - TOMM20

Gene ID NCBI Gene 9804 |  KEGG hsa:9804
Gene Symbol TOMM20
Protein Name translocase of outer mitochondrial membrane 20
Synonyms MAS20|MOM19|TOM20

Link

Ortholog resource in our bank

  TOMM20

External database

human TOMM20

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19895 pMAMtracker-Luc A reporter plasmid based on split-Luciferase for evaluating intracellular organelle (mitochondria-associated membrane).    
RDB19410 pFX-Tom20-SECFP Expression vector of SECFP with mitochondria-targeting sequence (human TOMM20) in mammalian cells.    
RDB17811 pN1-TOMM20-QUE37C ATP measurement, mitochondria outer membrane    
RDB17806 TOMM20-QUE37C/pLBS CAG ATP measurement, mitochondria outer membrane, lentivirus    
RDB17801 pT2MP.EF-TOMM-QUE37C ATP measurement, mitochondria outer membrane, Tol2 transposon    
RDB17799 pT2MP.EF-TOMM-BPEK ATP measurement, mitochondria outer membrane, Tol2 transposon    
RDB17798 pN1-TOMM20-BPEK ATP measurement, mitochondria outer membrane    
RDB17784 pN1-TOMM20-Q7mu Low concentration ATP measurement, mitochondria outer membrane    
RDB17776 pT2MP.EF-TOMM-QNA Negative control for ATP measurement, mitochondria outer membrane, Tol2 transposon    
RDB17772 pT2MP.EF-TOMM-Q7mu Low concentration ATP measurement, mitochondria outer membrane, Tol2 transposon    
RDB17757 pN1-TOMM20-QNA Negative control for ATP measurement, mitochondria outer membrane    
RDB17750 pN1-TOMM20-Halo Halo Tag, Mitochondrial outer membrane localization    
RDB16041 Tom20N-FLAG-GFP1-10 The split-GFP system clone for visualizing organelle contact sites in mammalian cells. probe: 3xFLAG-GFP1-10; location: mitochondria.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY066876 IRAK167D04 pBluescriptR BC066335 NM_014765 Full
HGX001732 IRAK004F12 pCMV-SPORT6 BC000882 NM_014765 Full
HGY103399 IRAL058I07 pOTB7 BC071994 NM_014765 Full
HGY090299 IRAL025M11 pOTB7 BC009886 NM_014765 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004106 W01A010E10 pENTR-TOPO IRAK004F12 BC000882 NM_014765  
HGE004110 W01A010E14 pENTR-TOPO IRAK004F12 BC000882 NM_014765  
HGE004112 W01A010E16 pENTR-TOPO IRAK004F12 BC000882 NM_014765  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074474 ARe86D02 pKA1U5 NM_014765.2  
CTTTCTGTGTTCCTGGCCCGCGGCCGTCGGGTGTGAGCTGCGCCGACCGCTCTGAGGGTT
HKR163346 ARi08G02 pGCAP10 NM_014765.2  
GCTTTTTCTTTCTGTGTTCCTGGCCCGCGGCCGTCGGGTGTGAGCTGCGCCGACCGCTCT
HKR333300 RBb33E04 pGCAP1 NM_014765.2  
GGTGCTCGGCCTTTCTGTGTTCCTGGCCCGCGGCCGTCGGGTGTGAGCTGCGCCGACCGC
HKR367722 RBd19F02 pGCAP10 NM_014765.2  
GCTTTCTGTGTTCCTGGCCCGCGGCCGTCGGGTGTGAGCTGCGCCGACCGCTCTGAGGGT
HKR392432 RBd81B08 pGCAP10 NM_014765.2  
GGCTCGGCCTTTCTGTGTTCCTGGCCCGCGGCCGTCGGGTGTGAGCTGCGCCGACCGCTC
HKR403087 RBdS007L23 pGCAP10 NM_014765.2  
GGCGGACGACCTCGAGGCCCTTAGTTGACTGGGACCGGAAGTGGCGTGTGCTCGGCCTTT
HKR405540 RBdS013O04 pGCAP10 NM_014765.2  
GGCCGACCGCTCTGAGGGTTCGTGGCCCACCGCTCCTTCGCGGTCCCTGCCGCCACCGTC
HKR462560 RBdS156G16 pGCAP10 NM_014765.2  
GCTTTTCTGTGTTCCTGGCCCGCGGCCGTCGGGTGTGAGCTGCGCCGACCGCTCTGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl