Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01589

HP ID(1) HP01589
Gene ID(2) 22913
Gene Symbol finder RALY
Protein Name RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))
RefSeq NM_016732.1
Length of RefSeq (bp) 1589
Chromosome 20q11.21-q11.23
Reference DDBJ accession
UniGene Hs.136947

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe69G04 pKA1U5 GGTCAGTGCGGCGGGGCGCGCGAGCGGCGCCAGCTCGGGGCAGCGGAACCCAGAGAAGCT
ARi48B10 pGCAP10 TGGCCTTACGTCCCCGAGTGCGGCAGTACCGCCTCCTTCCCAGCCGCGCGGCTTCCTCCA
ARi55D01 pGCAP10 GCGGCGGGGCGCGCGAGCGGCGCCAGCTCGGGGCAGCGGAACCCAGAGAAGCTGAGGGGG
ARiS088L18 pGCAP10 GGCGGCGGGGCGCGCGAGCGGCGCCAGCTCGGGGCAGCGGAACCCAGAGAAGCTGAGGGG
RBb19B03 pKA1U5 TGAGTGCGGCGGGGCGCGCGAGCGGCGCCAGCTCGGGGCAGCGGAACCCAGAGAAGCTGA
RBb41B02 pGCAP1 GAGGGCCGGAGCGGCGGGCGGAGCCGAGCTGCGGGGAGCCGCTCCGGGTGCCCCCACCCC
RBd71B03 pGCAP10 GAAGGAGGAGAGCCCGGAACCAGGGCCGGAGCGGCGGGCGGAGCCGAGCTGCGGGGAGCC
RBd77A03 pGCAP10 GGGCAGTACCGCCTCCTTCCCAGCCGCGCGGCTTCCTCCAGACCTCTCGGCGCGGGTGAG
RBdS014O23 pGCAP10 GGCTTCCTCCAGACCTCTCGGCGCGGGTGAGCCCTATTCCCAGAGGCAGGTGGTGCTGAC
RBdS040K06 pGCAP10 GAGACTCCTCGTGCTCGTGTCACCGTGTCCTTCCCAGGAGACAGAGAAGGAGGAGAGCCC
RBdS177M16 pGCAP10 GCAGTGCGGCGGGGCGCGCGAGCGGCGCCAGCTCGGGGCAGCGGAACCCAGAGAAGCTGA
RBdS187B07 pGCAP10 TACCATCTTCTCTAAGTATGGCCGTGTGGCCGGCTGTTCTGTGCACAAGGGCTATGCCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl