Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01586

HP ID(1) HP01586
Gene ID(2) 25796
Gene Symbol finder PGLS
Protein Name 6-phosphogluconolactonase
RefSeq NM_012088.2
Length of RefSeq (bp) 1043
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.466165

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi13G11 pGCAP10 GTCCTCCTCCCCGCCGCCGCCCTCGCCATGGCCGCGCCGGCCCCGGGCCTCATCTCGGTG
ARi58E01 pGCAP10 GCTCCCCGCCGCCGCCCTCGCCATGGCCGCGCCGGCCCCGGGCCTCATCTCGGTGTTCTC
ARiS013I05 pGCAP10 GCCTCCTCCCCGCCNCCGCCCTCGCCATGGCCGCGCCGGCCCCGGGCCTCATCTCGGTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl