Prev. |  KEGG KO K01057 > 

RIKEN DNA Bank Human Resource - PGLS

Gene ID NCBI Gene 25796 |  KEGG hsa:25796
Gene Symbol PGLS
Protein Name 6-phosphogluconolactonase
Synonyms 6PGL|HEL-S-304
Ortholog resources KEGG ortholog (KEGG orthology K01057) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091369 IRAL028H01 pOTB7 BC014006 NM_012088 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE099234 M01C048B10 pDONR221 MGC13-H05 BC014006 NM_012088  
HGE099282 M01C048D10 pDONR221 MGC13-H05 BC014006 NM_012088  
HGE099330 M01C048F10 pDONR221 MGC13-H05 BC014006 NM_012088  
HGE099378 M01C048H10 pDONR221 MGC13-H05 BC014006 NM_012088  
HGE099426 M01C048J10 pDONR221 MGC13-H05 BC014006 NM_012088  
HGE099474 M01C048L10 pDONR221 MGC13-H05 BC014006 NM_012088  
HGE099522 M01C048N10 pDONR221 MGC13-H05 BC014006 NM_012088  
HGE099570 M01C048P10 pDONR221 MGC13-H05 BC014006 NM_012088  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR165355 ARi13G11 pGCAP10 NM_012088.2  
GTCCTCCTCCCCGCCGCCGCCCTCGCCATGGCCGCGCCGGCCCCGGGCCTCATCTCGGTG
HKR183297 ARi58E01 pGCAP10 NM_012088.2  
GCTCCCCGCCGCCGCCCTCGCCATGGCCGCGCCGGCCCCGGGCCTCATCTCGGTGTTCTC
HKR205397 ARiS013I05 pGCAP10 NM_012088.2  
GCCTCCTCCCCGCCNCCGCCCTCGCCATGGCCGCGCCGGCCCCGGGCCTCATCTCGGTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl