Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01550

HP ID(1) HP01550
Gene ID(2) 51025
Gene Symbol finder PAM16
Protein Name presequence translocase-associated motor 16 homolog (S. cerevisiae)
RefSeq NM_016069.9
Length of RefSeq (bp) 600
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.644614

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb06E08 pKA1U5 GACGCTTGATCCCCGGCCGCGGGGCCAGGAAGTCGGAGTTTGAGCCCCGGAGGCAGAGCG
RBb39H05 pGCAP1 GGGAGTTTGAGCCCCGGAGGCAGAGCGGCTGCCATGGCCAAGTACCTGGCCCAGATCATT
RBdS070H11 pGCAP10 GGCCGACCACGCTTGATCCCCGGCCGCGGGGCCAGGAAGTCGGAGTTTGAGCCCCGGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl