Prev. |  KEGG KO K17805 > 

RIKEN DNA Bank Human Resource - PAM16

Gene ID NCBI Gene 51025 |  KEGG hsa:51025
Gene Symbol PAM16
Protein Name presequence translocase associated motor 16
Synonyms CGI-136|MAGMAS|SMDMDM|TIM16|TIMM16
Ortholog resources KEGG ortholog (KEGG orthology K17805) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087495 IRAL018M07 pOTB7 BC005024 NM_016069 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR322504 RBb06E08 pKA1U5 NM_016069.9  
GACGCTTGATCCCCGGCCGCGGGGCCAGGAAGTCGGAGTTTGAGCCCCGGAGGCAGAGCG
HKR335773 RBb39H05 pGCAP1 NM_016069.9  
GGGAGTTTGAGCCCCGGAGGCAGAGCGGCTGCCATGGCCAAGTACCTGGCCCAGATCATT
HKR428179 RBdS070H11 pGCAP10 NM_016069.9  
GGCCGACCACGCTTGATCCCCGGCCGCGGGGCCAGGAAGTCGGAGTTTGAGCCCCGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl