Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01527

HP ID(1) HP01527
Gene ID(2) 10443
Gene Symbol finder N4BP2L2
Protein Name NEDD4 binding protein 2-like 2
RefSeq NM_014887.2
Length of RefSeq (bp) 2860
Chromosome 13q13.1
Reference DDBJ accession
UniGene Hs.507680

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe29D05 pKA1U5 GATCTTGCGTACGGAGGTGAGGTTTGTTACCGCGATTCTGAGAGGTGGGCTTTTAGTCCC
RBd80G02 pGCAP10 AATACCGCCATCTTGCGTACGGAGGTGAGGTTTGTTACCGCGATTCTGAGAGGTGGGCTT
RBdS007A07 pGCAP10 GGGAAAAGTCAGCTGGTTGTCTTCTAGAAAGCTCTAAGAAGCATGCACTGAGAGCCGATT
RBdS156E12 pGCAP10 AATGGAGGTGACCGCCATCTTGCGTACGGAGGTGAGGTTTGTTACCGCGATTCTGAGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl