Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - N4BP2L2

Gene ID (NCBI) 10443
Gene Symbol N4BP2L2
Protein Name NEDD4 binding protein 2-like 2
Synonyms 92M18.3|CG005|PFAAP5
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005210 IRAK013A10 pCMV-SPORT6 BC010643 NM_014887 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR051677 ARe29D05 pKA1U5 NM_014887.2
GATCTTGCGTACGGAGGTGAGGTTTGTTACCGCGATTCTGAGAGGTGGGCTTTTAGTCCC
HKR392146 RBd80G02 pGCAP10 NM_014887.2
AATACCGCCATCTTGCGTACGGAGGTGAGGTTTGTTACCGCGATTCTGAGAGGTGGGCTT
HKR402807 RBdS007A07 pGCAP10 NM_014887.2
GGGAAAAGTCAGCTGGTTGTCTTCTAGAAAGCTCTAAGAAGCATGCACTGAGAGCCGATT
HKR462508 RBdS156E12 pGCAP10 NM_014887.2
AATGGAGGTGACCGCCATCTTGCGTACGGAGGTGAGGTTTGTTACCGCGATTCTGAGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl