Prev. | 

RIKEN DNA Bank Human Resource - N4BP2L2

Gene ID NCBI Gene 10443 |  KEGG hsa:10443
Gene Symbol N4BP2L2
Protein Name NEDD4 binding protein 2 like 2
Synonyms 92M18.3|CG005|CG016|PFAAP5
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005210 IRAK013A10 pCMV-SPORT6 BC010643 NM_014887 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051677 ARe29D05 pKA1U5 NM_014887.2  
GATCTTGCGTACGGAGGTGAGGTTTGTTACCGCGATTCTGAGAGGTGGGCTTTTAGTCCC
HKR392146 RBd80G02 pGCAP10 NM_014887.2  
AATACCGCCATCTTGCGTACGGAGGTGAGGTTTGTTACCGCGATTCTGAGAGGTGGGCTT
HKR402807 RBdS007A07 pGCAP10 NM_014887.2  
GGGAAAAGTCAGCTGGTTGTCTTCTAGAAAGCTCTAAGAAGCATGCACTGAGAGCCGATT
HKR462508 RBdS156E12 pGCAP10 NM_014887.2  
AATGGAGGTGACCGCCATCTTGCGTACGGAGGTGAGGTTTGTTACCGCGATTCTGAGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl