Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01496

HP ID(1) HP01496
Gene ID(2) 4708
Gene Symbol finder NDUFB2
Protein Name NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa
RefSeq NM_004546.2
Length of RefSeq (bp) 509
Chromosome 7q34
Reference DDBJ accession
UniGene Hs.655788

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05G05 pKA1U5 GGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGGCGTCTTTCG
ARe33D05 pKA1U5 GAGCGAGTATGTCCGCTCTGACTCGGCTGGCGCTCTTTCGCTCGCGTTGGAGGCCGCCTT
ARe82D03 pKA1U5 GGCGGGGCGGAGCGCCGGGGAAGCGAAGTAGGCAGGGGCGAGGCGGCTGGGGACCGCGGG
ARe91D03 pKA1U5 GGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGG
ARi19E10 pGCAP10 GAGGGGCGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTC
ARi71F11 pGCAP10 GAGGCAGGGGCGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTG
ARiS055I19 pGCAP10 GGGGCNAGGCGNCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGG
ARiS088D10 pGCAP10 GGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGGCGTCTTTCG
ARiS191J11 pGCAP10 GGGCGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGC
RBb14H07 pKA1U5 TGGAGGCGGCTGGGGTACCGCGGGGCGGACGGCCCNTTAGATATGTCCGCTCTGACTCGG
RBb37F06 pGCAP1 GAGGCAGGGGCGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTG
RBb49C01 pGCAP1 GGGGGAAGCGAAGTAGGCAGGGGCGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAG
RBb58E08 pGCAP1 GGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGGCGTCTTTCGC
RBb66H02 pGCAP1 GAGGCGGAGGAAGCAGCGTGCGCGGCGGGTGTGGACGCTCCTGGAGCGAGGCGGGGGGCG
RBd11B06 pGCAP10 GGCGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCT
RBd11G04 pGCAP10 GGAGGCCGCTGGGGACCGCGGGGCGNGACGGGAGCTAGTATGTCCGCTCTGACTCGGCTG
RBd15H07 pGCAP10 GGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGGCGTCTTTCG
RBd26A02 pGCAP10 GGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl