Prev. |  KEGG KO K03958 > 

RIKEN DNA Bank Human Resource - NDUFB2

Gene ID NCBI Gene 4708 |  KEGG hsa:4708
Gene Symbol NDUFB2
Protein Name NADH:ubiquinone oxidoreductase subunit B2
Synonyms AGGG|CI-AGGG
Ortholog resources KEGG ortholog (KEGG orthology K03958) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056129 IRAK140F09 pCMV-SPORT6 BC063026 NM_004546 Full/var
HGY083313 IRAL008E17 pOTB7 BC001168 NM_004546 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096031 M01C040B07 pDONR221 MGC09-G04 BC063026 ENST00000247866  
HGE096079 M01C040D07 pDONR221 MGC09-G04 BC063026 ENST00000247866  
HGE096127 M01C040F07 pDONR221 MGC09-G04 BC063026 ENST00000247866  
HGE096175 M01C040H07 pDONR221 MGC09-G04 BC063026 ENST00000247866  
HGE096223 M01C040J07 pDONR221 MGC09-G04 BC063026 ENST00000247866  
HGE096271 M01C040L07 pDONR221 MGC09-G04 BC063026 ENST00000247866  
HGE096319 M01C040N07 pDONR221 MGC09-G04 BC063026 ENST00000247866  
HGE096367 M01C040P07 pDONR221 MGC09-G04 BC063026 ENST00000247866  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042149 ARe05G05 pKA1U5 NM_004546.2  
GGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGGCGTCTTTCG
HKR053277 ARe33D05 pKA1U5 NM_004546.2  
GAGCGAGTATGTCCGCTCTGACTCGGCTGGCGCTCTTTCGCTCGCGTTGGAGGCCGCCTT
HKR072875 ARe82D03 pKA1U5 NM_004546.2  
GGCGGGGCGGAGCGCCGGGGAAGCGAAGTAGGCAGGGGCGAGGCGGCTGGGGACCGCGGG
HKR076475 ARe91D03 pKA1U5 NM_004546.2  
GGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGG
HKR167706 ARi19E10 pGCAP10 NM_004546.2  
GAGGGGCGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTC
HKR188531 ARi71F11 pGCAP10 NM_004546.2  
GAGGCAGGGGCGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTG
HKR222211 ARiS055I19 pGCAP10 NM_004546.2  
GGGGCNAGGCGNCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGG
HKR235282 ARiS088D10 pGCAP10 NM_004546.2  
GGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGGCGTCTTTCG
HKR276627 ARiS191J11 pGCAP10 NM_004546.2  
GGGCGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGC
HKR325775 RBb14H07 pKA1U5 NM_004546.2  
TGGAGGCGGCTGGGGTACCGCGGGGCGGACGGCCCNTTAGATATGTCCGCTCTGACTCGG
HKR334926 RBb37F06 pGCAP1 NM_004546.2  
GAGGCAGGGGCGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTG
HKR339649 RBb49C01 pGCAP1 NM_004546.2  
GGGGGAAGCGAAGTAGGCAGGGGCGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAG
HKR343304 RBb58E08 pGCAP1 NM_004546.2  
GGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGGCGTCTTTCGC
HKR346570 RBb66H02 pGCAP1 NM_004546.2  
GAGGCGGAGGAAGCAGCGTGCGCGGCGGGTGTGGACGCTCCTGGAGCGAGGCGGGGGGCG
HKR364430 RBd11B06 pGCAP10 NM_004546.2  
GGCGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCT
HKR364548 RBd11G04 pGCAP10 NM_004546.2  
GGAGGCCGCTGGGGACCGCGGGGCGNGACGGGAGCTAGTATGTCCGCTCTGACTCGGCTG
HKR366175 RBd15H07 pGCAP10 NM_004546.2  
GGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGGCGTCTTTCG
HKR370402 RBd26A02 pGCAP10 NM_004546.2  
GGAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl