Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01451

HP ID(1) HP01451
Gene ID(2) 7163
Gene Symbol finder TPD52
Protein Name tumor protein D52
RefSeq NM_005079.2
Length of RefSeq (bp) 3966
Chromosome 8q21
Reference DDBJ accession
UniGene Hs.368433

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe46H03 pKA1U5 GGCGCGGCGCGGCGGGCGATCCGAGCCGGGACGGGCTGCAGGCGGGGGTGCTGCAGAGGA
ARi54E10 pGCAP10 GGGCGCGGCGGGCGATCCGAGCCGGGACGGGCTGCAGGCGGGGGTGCTGCAGAGGACACG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl