Prev. | 

RIKEN DNA Bank Human Resource - TPD52

Gene ID NCBI Gene 7163 |  KEGG hsa:7163
Gene Symbol TPD52
Protein Name tumor protein D52
Synonyms D52|N8L|PC-1|PrLZ|hD52
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX009175 IRAK022P15 pCMV-SPORT6 BC018117 NM_005079 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080805 M01C002A05 pDONR221 04-134-2_1-E03 BC018117 NM_005079  
HGE080853 M01C002C05 pDONR221 04-134-2_1-E03 BC018117 NM_005079  
HGE080901 M01C002E05 pDONR221 04-134-2_1-E03 BC018117 NM_005079  
HGE080949 M01C002G05 pDONR221 04-134-2_1-E03 BC018117 NM_005079  
HGE080997 M01C002I05 pDONR221 04-134-2_1-E03 BC018117 NM_005079  
HGE081045 M01C002K05 pDONR221 04-134-2_1-E03 BC018117 NM_005079  
HGE081093 M01C002M05 pDONR221 04-134-2_1-E03 BC018117 NM_005079  
HGE081141 M01C002O05 pDONR221 04-134-2_1-E03 BC018117 NM_005079  
HGE092408 M01C031A08 pDONR221 MGC05-B04 BC018117 NM_005079  
HGE092456 M01C031C08 pDONR221 MGC05-B04 BC018117 NM_005079  
HGE092504 M01C031E08 pDONR221 MGC05-B04 BC018117 NM_005079  
HGE092552 M01C031G08 pDONR221 MGC05-B04 BC018117 NM_005079  
HGE092600 M01C031I08 pDONR221 MGC05-B04 BC018117 NM_005079  
HGE092648 M01C031K08 pDONR221 MGC05-B04 BC018117 NM_005079  
HGE092696 M01C031M08 pDONR221 MGC05-B04 BC018117 NM_005079  
HGE092744 M01C031O08 pDONR221 MGC05-B04 BC018117 NM_005079  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058571 ARe46H03 pKA1U5 NM_005079.2  
GGCGCGGCGCGGCGGGCGATCCGAGCCGGGACGGGCTGCAGGCGGGGGTGCTGCAGAGGA
HKR181706 ARi54E10 pGCAP10 NM_005079.2  
GGGCGCGGCGGGCGATCCGAGCCGGGACGGGCTGCAGGCGGGGGTGCTGCAGAGGACACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl