Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01448

HP ID(1) HP01448
Gene ID(2) 4696
Gene Symbol finder NDUFA3
Protein Name NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
RefSeq NM_004542.2
Length of RefSeq (bp) 359
Chromosome 19q13.42
Reference DDBJ accession
UniGene Hs.198269

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06D10 pKA1U5 GCCGCTGTCGCCGCCGCGGAGACAAAGATGGCTGCGAGAGTCGGCGCCTTCCTCAAGAAT
ARi54H11 pGCAP10 GGCCGCTGTCGCCGCCGCGGAGACAAAGATGGCTGCGAGAGTCGGCGCCTTCCTCAAGAA
ARiS122A21 pGCAP10 GGCCNCNGANACAAAGATGGCTGCGAGAGTCGGCGCCTTCCTCAAGAATGCCTGGGACAA
RBd19F09 pGCAP10 GGCTGTCGCCCCCACGGACCTTGTATGGATGCGAGAGTCCGCTCCTTCCTCAAGAATGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl